Home Takara Clontech Logo Takara Clontech
login | register | order now | view cart | feedback
Products
PCR Products


Products >  PCR_Products >  Pathogen_Detection_and_Screening_Kits >  Human_Pathogen_Detection >  Human_Beta-globin_Control_Primer_Set

Human Beta-globin Control Primer Set

Takara's Human Beta-globin Control Primer Set contains a set of PCR primers that recognizes the human beta-globin gene at chromosome 11. Beta-globin makes up about half of the human hemoglobin tertrameric protein; in the normal human adult, the hemoglobin tetramer consists of two alpha chains and two beta chains. The Human Beta-globin Control Primer Set may be used as a experimental control during protocols such as PCR.    

Primer Sequences

PC03(forward)d(ACACAACTGTGTTCACTAGC)
PC04(reverse)d(CAACTTCATCCACGTTCACC)
GH20(forward)d(GAAGAGCCAAGGACAGGTAC)
GH21(reverse)d(GGAAAATAGACCAATAGGCAG)
KM29(forward)d(GGTTGGCCAATCTACTCCCAGG)
KM38(reverse)d(TGGTCTCCTTAAACCTGTCTTG)

  At-A-Glance   Documents   Images & Data

Applications

  • PCR amplifications
  • Positive experimental control

Storage

–20°C

Notes

Some templates may not be efficiently amplified using the PC03 primer. In these cases, please use a different primer pair.

Amplified Fragment (bp)
reversePC04GH21KM38
forward
PC03110250167
GH20268408325
KM29205345262

Form

Lyophilized. Reconstitute with sterilized distilled water or TE buffer.

References

  1. Saiki, R.K. et al. (1988) Science 239:487-491.
  2. Coutlée, F. et al. (1999) J. Clin. Microbiol. 37(6):1852–1857.

Quality

Confirmed by HPLC. Primer integrity confirmed by PCR.




 
 
Products
Cat. # Product Contents Size Price Units Select
3868 Beta-globin (Human) Primer Set 1 Set $186.00
 

 

 
 

Clontech is a Takara Bio Company © 2014 Privacy Policy | Terms & Conditions