Clontech
login | register | order now | view cart | feedback

Thats_Good_Science >  Translational_Research >  Resources >  Case_Studies >  Direct_PCR_from_Blood

Translational Research | Case Studies
That's Good Science!

Translational Research | Case Studies

PCR Amplification of Y–Chromosomal DNA Directly From Male Blood

Terra direct PCR kit and the Philisa thermal cycler improve sample turnaround times

Christopher M. Connelly, Ph.D., Research and Development Division, Streck Inc., LaVista, NE

The purpose of this study was to evaluate the Terra PCR Direct Polymerase Mix from Clontech to determine if it can facilitate DNA amplification directly from male whole blood using two conventional thermal cycling platforms; Streck's Philisa® Rapid Thermal Cycler and the Biometra TGradient Thermal Cycler. Purification of DNA prior to PCR analysis is a labor– and time–intensive process. Removal of the purification step will benefit molecular diagnostic laboratories by improving sample turnaround times and expediting time–critical results.

The study results demonstrate that Terra PCR Direct Polymerase Mix successfully amplified a Y–chromosomal sex–determining region (SRY) gene amplicon from male whole blood at all concentrations tested (2.5–30%). Data was obtained using the manufacturer's recommendations with minimal alteration to the PCR protocol. The Philisa Rapid Thermal Cycler completed the standard protocol 30 minutes faster than the Biometra Thermal Cycler due to the difference in ramp rate between cyclers.

Materials and Methods

Testing was performed at Streck Laboratories with Terra PCR Direct Polymerase Mix provided by Clontech Laboratories.

The Terra Direct PCR Polymerase Mix was used as per manufacturer's recommendations, with the following modification: The polymerase extension time was extended to 60 seconds total, rather than the recommended 60 seconds/kb of DNA. For sample volumes, blood (1.25–15 µl) was added at the indicated % concentrations (2.5–30%), based on a 50 µl reaction volume. Samples were visualized on a 1.5% agarose gel using ethidium bromide at a 0.5 µg/ml working concentration.

Tests were performed using the SRY primer set:
F: 5'–CGCATTCATCGTGTGGTCTCGCG–3'
R: 5'–CTGTGCCTCCTGGAAGAATGGCC–3'

15 ng Human male genomic DNA (Promega) was used as a purified positive template control (PTC). No template control (NTC) was prepared by addition of MB grade nuclease–free water (USB Corporation).

Human male whole blood samples were analyzed using the Streck Philisa Rapid Thermal Cycler and Philisa PCR Tubes or the Biometra TGradient Thermal Cycler under the following conditions: 98°C, 120 sec; followed by 40 cycles of: 98°C, 10 sec; 60°C, 15 sec; 68°C, 60 sec.

The total time for amplification with the Philisa Rapid Thermal Cycler was 55 minutes. The total time for amplification with the Biometra Thermal Cycler was 1 h 25 minutes.

Results and Discussion

Figure 1 shows that the SRY PCR product was successfully amplified for all samples prepared with increasing concentrations of human male whole blood, as indicated by the representative 148 base pair SRY PCR amplicon. Smaller gel bands are primer dimers and not relevant to the amplified SRY product. Band intensity on the gel appeared similar between thermal cyclers regardless of whole blood concentration. Amplification of SRY DNA was approximately 30 minutes faster on the Philisa Thermal Cycler, presumably due to the faster ramp rate.

The successful amplification of SRY gene fragments from whole blood spiked directly into a PCR tube using the Terra PCR Direct Polymerase Mix was demonstrated. This indicates that Terra PCR Direct Polymerase Mix can be utilized for genomic DNA detection with direct PCR applications using human whole blood as the crude sample matrix.

Figure 1. Agarose gel depicting SRY amplicon detection by PCR with Terra PCR Direct Polymerase Mix using increasing concentrations of human male whole blood. The total amplification time was 55 minutes for the Philisa Thermal Cycler (top) and 85 minutes for the Biometra Thermal Cycler (bottom).

Resource

  1. Direct PCR Citation List

Visit the Terra PCR Direct Polymerase product page >>

Top of page

That's Good Scienceâ„¢
Takara Bio USA is a Takara Bio Company © 2017 Privacy Policy | Terms & Conditions | Terms of Use